Mature sequence aly-miR3447-3p

Accession numberMIMAT0017730
IDaly-miR3447-3p
Previous IDsaly-miR3447
Stem-Loop aly-MIR3447
Sequence
uuugaguguguuuguuaugaa
Get sequence
Deep sequencing62 reads, 1 experiments
Database links
QuickGO function

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).