Mature sequence aly-miR3449-5p

Accession numberMIMAT0017733
IDaly-miR3449-5p
Previous IDsaly-miR3449
Stem-Loop aly-MIR3449
Sequence
ucuagauugcuuucggucugu
Get sequence
Deep sequencing2 reads, 1 experiments

References

1
PMID:20407027 "MicroRNA gene evolution in Arabidopsis lyrata and Arabidopsis thaliana" Fahlgren N, Jogdeo S, Kasschau KD, Sullivan CM, Chapman EJ, Laubinger S, Smith LM, Dasenko M, Givan SA, Weigel D, Carrington JC Plant Cell. 22:1074-1089(2010).