Mature sequence rno-miR-3556b

Accession numberMIMAT0017818
IDrno-miR-3556b
Stem-Loop rno-mir-3556b-1 rno-mir-3556b-2
Sequence
accgauuucaaauggugcua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).