Mature sequence aly-miR4226

Accession numberMIMAT0017914
IDaly-miR4226
Stem-Loop aly-MIR4226
Sequence
uacaagaugcauucgagcaaua
Get sequence
Deep sequencing reads, experiments

References

1