Mature sequence aly-miR4229

Accession numberMIMAT0017917
IDaly-miR4229
Stem-Loop aly-MIR4229
Sequence
uuggcagggagguccuccacac
Get sequence
Deep sequencing reads, experiments

References

1