Mature sequence aly-miR4232

Accession numberMIMAT0017921
IDaly-miR4232
Stem-Loop aly-MIR4232
Sequence
ucacauuuauuaggaugugugc
Get sequence
Deep sequencing reads, experiments

References

1