Mature sequence aly-miR4233

Accession numberMIMAT0017922
IDaly-miR4233
Stem-Loop aly-MIR4233
Sequence
cacaucaucaacaucaacucc
Get sequence
Deep sequencing reads, experiments

References

1