Mature sequence aly-miR4238

Accession numberMIMAT0017927
IDaly-miR4238
Stem-Loop aly-MIR4238
Sequence
uuuuugcaaauuaaaaccccaa
Get sequence
Deep sequencing reads, experiments

References

1