Mature sequence aly-miR4244

Accession numberMIMAT0017933
IDaly-miR4244
Stem-Loop aly-MIR4244
Sequence
uuguugauuccuuggagauug
Get sequence
Deep sequencing reads, experiments

References

1