Mature sequence aly-miR4248a

Accession numberMIMAT0017937
IDaly-miR4248a
Stem-Loop aly-MIR4248a
Sequence
acauuuuauuuuuggcaauca
Get sequence
Deep sequencing reads, experiments

References

1