Mature sequence ath-miR4221

Accession numberMIMAT0017942
IDath-miR4221
Stem-Loop ath-MIR4221
Sequence
uuuuccucuguugaauucuugc
Get sequence
Deep sequencing reads, experiments

References

1