Mature sequence ath-miR4240

Accession numberMIMAT0017948
IDath-miR4240
Stem-Loop ath-MIR4240
Sequence
ugacuagacccguaacauuac
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).