Mature sequence tae-miR319

Accession numberMIMAT0018211
IDtae-miR319
Stem-Loop tae-MIR319
Sequence
uuggacugaagggagcucccu
Get sequence
Deep sequencing148317607 reads, 116 experiments

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).