Stem-loop tae-MIR319

Accession

MI0016453

Description

Triticum aestivum tae-MIR319 precursor miRNA

Literature search

13 open access papers mention tae-MIR319
(40 sentences)

Sequence

42450 reads, 208 reads per million, 115 experiments

aguuugagggagcucacuucaguccacucaugggagguagcggggauugaacgagcugccgacucauucacucgagcacacaguagauaugagacuaguccagggcauaccaguauguuacaauauguacugugcgaaugagcgaaugcagcgggagauuguucucucuuuccuccuccaugcUUGGACUGAAGGGAGCUCCCUcaucucu
....(((((((((((.((((((((((..(((((.(((.((.(((((..((((((.((.(((.(((((((.((((..(.(((((((.((((..(((.......((.....)).....)))...)))).))))))).)..)))).))))).))))).)).))))))..))))).))))))))))..)))))))))).))))))))))).....

Structure

-aguu           a          cu     g   u  c     uu      g  g   a  -     a    ag a       g    -ga   uagucca  g 
     ugagggagcuc cuucagucca  caugg agg ag gggga  gaacga cu ccg cu cauuc cucg  c cacagua auau   gac       gg c
     ||||||||||| ||||||||||  ||||| ||| || |||||  |||||| || ||| || ||||| ||||  | ||||||| ||||   |||       || a
     acUCCCUCGAG GAAGUCAGGU  guacc ucc uc uuucu  cuuguu ga ggc ga guaag gagu  g gugucau uaua   uug       cc u
ucucu           G          Uc     -   -  c     cu      a  g   -  c     c    aa c       g    aca   --uauga  a 

Annotation confidence Low

Genome context

4D: 46944255-46944465 [-]

Mature tae-miR319

• Accession: MIMAT0018211
• Description: Triticum aestivum tae-miR319 mature miRNA
• Sequence: 184 - UUGGACUGAAGGGAGCUCCCU - 204
• Evidence: not_experimental

References

1. PubMed ID: 18521122
   Data mining for miRNAs and their targets in the Triticeae
   "Dryanova A, Zakharov A, Gulick PJ"
   "Genome (2008) 51:433-443