Mature sequence tae-miR169

Accession numberMIMAT0018219
IDtae-miR169
Stem-Loop tae-MIR169
Sequence
gggcaagucacccugggcuacc
Get sequence
Deep sequencing59 reads, 58 experiments

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).