Mature sequence gma-miR4382

Accession numberMIMAT0018289
IDgma-miR4382
Stem-Loop gma-MIR4382
Sequence
uauguuaacugauuucauggau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).