Mature sequence gma-miR1520o

Accession numberMIMAT0018296
IDgma-miR1520o
Stem-Loop gma-MIR1520o
Sequence
ucaucguccaaucagaaugugaca
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).