Mature sequence ssc-miR-126-3p

Accession numberMIMAT0018378
IDssc-miR-126-3p
Previous IDsssc-miR-126
Stem-Loop ssc-mir-126
Sequence
ucguaccgugaguaauaaugcg
Get sequence
Deep sequencing28592 reads, 15 experiments

References

1
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).