Mature sequence hvu-miR1120

Accession numberMIMAT0018499
IDhvu-miR1120
Stem-Loop hvu-MIR1120
Sequence
acauucuuauauuaugggacggag
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
2
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).