Accession | MIMAT0019018 |
Description | hsa-miR-4484 mature miRNA |
Hairpins | |
Sequence | AAAAGGCGGGAGAAGCCCCA |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
located_in | GO:0070062 extracellular exosome |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31926946 | produced_by CL:0000235 |
located_in | GO:1903561 extracellular vesicle |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:28798470 | produced_by CL:0000182 |