Stem-loop hsa-mir-4484

Accession

MI0016845

Symbol

HGNC: MIR4484

Description

Homo sapiens hsa-mir-4484 precursor miRNA mir-4484

Gene
family

RF03861; mir-4484

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR4484 is identified as an RNA gene located on chromosome 10 at the q26.2 locus, which is suggested to function as a tumor suppressor [PMC6776520]. Research has shown that the MIR4484 locus is subject to copy number loss, as demonstrated by quantitative PCR assays targeting the genomic region that includes the miRNA precursor sequence [PMC5537698]. The copy number determination for MIR4484, alongside UROS, was normalized against GAPDH using the ΔΔCt method to ensure accurate quantification [PMC5537698]. The study also included an analysis of genes adjacent to UROS, such as BCCIP and MMP21, to assess if deletions at the UROS locus also affected these neighboring genes [PMC5537698]. However, particular attention was given to MMP21 due to its proximity to MIR4484 and its known involvement in fibrotic processes in systemic sclerosis (SSc), which could suggest a functional relationship between MMP21 and MIR4484 [PMC6776520]. The deletion patterns of MIR4484 were correlated with those of UROS by using a consistent sample set for DNA qPCR analysis [PMC5537698], indicating that changes in genomic content could be systematically evaluated for these genes.

Literature search

8 open access papers mention hsa-mir-4484
(14 sentences)

Sequence

2021 reads, 182 reads per million, 86 experiments

ggguuuccucugccuuuuuuuccaaugaaaauaacgaaaccuguuauuucccauugagggggaAAAAGGCGGGAGAAGCCCCA
(((((((.(((((((((((((((((((.((((((((.....))))))))..))))...))))))))))))))).)))))))..

Structure

--       c               ---    -a        a 
  ggguuuc ucugccuuuuuuucc   aaug  aaauaacg a
  ||||||| |||||||||||||||   ||||  |||||||| a
  CCCGAAG GGGCGGAAAAagggg   uuac  uuuauugu c
AC       A               gag    cc        c 

Annotation confidence Not enough data

Genome context

chr10: 125819740-125819822 [+]

Disease association

hsa-mir-4484 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-4484

• Accession: MIMAT0019018
• Description: Homo sapiens hsa-miR-4484 mature miRNA
• Sequence: 64 - AAAAGGCGGGAGAAGCCCCA - 83
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127