miRBase entry: hsa-mir-4484

Stem-loop hsa-mir-4484


Accession
MI0016845
Symbol
HGNC: MIR4484
Description
Homo sapiens hsa-mir-4484 precursor miRNA mir-4484
Gene
family?
RF03861; mir-4484

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR4484 is identified as an RNA gene located on chromosome 10 at the q26.2 locus, which is suggested to function as a tumor suppressor [PMC6776520]. Research has shown that the MIR4484 locus is subject to copy number loss, as demonstrated by quantitative PCR assays targeting the genomic region that includes the miRNA precursor sequence [PMC5537698]. The copy number determination for MIR4484, alongside UROS, was normalized against GAPDH using the ΔΔCt method to ensure accurate quantification [PMC5537698]. The study also included an analysis of genes adjacent to UROS, such as BCCIP and MMP21, to assess if deletions at the UROS locus also affected these neighboring genes [PMC5537698]. However, particular attention was given to MMP21 due to its proximity to MIR4484 and its known involvement in fibrotic processes in systemic sclerosis (SSc), which could suggest a functional relationship between MMP21 and MIR4484 [PMC6776520]. The deletion patterns of MIR4484 were correlated with those of UROS by using a consistent sample set for DNA qPCR analysis [PMC5537698], indicating that changes in genomic content could be systematically evaluated for these genes.

Literature search
8 open access papers mention hsa-mir-4484
(14 sentences)

Sequence

1952 reads, 182 reads per million, 81 experiments
ggguuuccucugccuuuuuuuccaaugaaaauaacgaaaccuguuauuucccauugagggggaAAAAGGCGGGAGAAGCCCCA
(((((((.(((((((((((((((((((.((((((((.....))))))))..))))...))))))))))))))).)))))))..

Structure
--       c               ---    -a        a 
  ggguuuc ucugccuuuuuuucc   aaug  aaauaacg a
  ||||||| |||||||||||||||   ||||  |||||||| a
  CCCGAAG GGGCGGAAAAagggg   uuac  uuuauugu c
AC       A               gag    cc        c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 125819740-125819822 [+]

Disease association
hsa-mir-4484 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4484

Accession MIMAT0019018
Description Homo sapiens hsa-miR-4484 mature miRNA
Sequence 64 - AAAAGGCGGGAGAAGCCCCA - 83
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127