Mature sequence tca-miR-9b-5p

Accession numberMIMAT0019134
IDtca-miR-9b-5p
Stem-Loop tca-mir-9b
Sequence
cuuugguaauuuagcguuugu
Get sequence
Deep sequencing reads, experiments
Database links
QuickGO function

References

1
PMID:18571123 "Genome-wide mapping of conserved microRNAs and their host transcripts in Tribolium castaneum" Luo Q, Zhou Q, Yu X, Lin H, Hu S, Yu J J Genet Genomics. 35:349-355(2008).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).