Mature sequence oar-miR-668-3p

Accession numberMIMAT0019311
IDoar-miR-668-3p
Stem-Loop oar-mir-668
Sequence
augucacucggcccacuaccc
Get sequence
Deep sequencing57 reads, 8 experiments

References

1
PMID:20944086 "Assessing the effect of the CLPG mutation on the microRNA catalog of skeletal muscle using high-throughput sequencing" Caiment F, Charlier C, Hadfield T, Cockett N, Georges M, Baurain D Genome Res. 20:1651-1662(2010).