Mature sequence hsa-miR-3960

Accession numberMIMAT0019337
IDhsa-miR-3960
Stem-Loop hsa-mir-3960
Sequence
ggcggcggcggaggcggggg
Get sequence
Deep sequencing421 reads, 78 experiments
Predicted targets

References

1
PMID:21324897 "A Runx2/miR-3960/miR-2861 regulatory feedback loop during mouse osteoblast differentiation" Hu R, Liu W, Li H, Yang L, Chen C, Xia ZY, Guo LJ, Xie H, Zhou HD, Wu XP, Luo XH J Biol Chem. 286:12328-12339(2011).