Mature sequence cel-miR-4809-3p

Accession numberMIMAT0019994
IDcel-miR-4809-3p
Previous IDscel-miR-4809
Stem-Loop cel-mir-4809
Sequence
uaauacaacuucugggcuuccag
Get sequence
Deep sequencing23 reads, 9 experiments

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).
2
PMID:21177960 "Computational and experimental identification of mirtrons in Drosophila melanogaster and Caenorhabditis elegans" Chung WJ, Agius P, Westholm JO, Chen M, Okamura K, Robine N, Leslie CS, Lai EC Genome Res. 21:286-300(2011).