Mature sequence cel-miR-4812-5p

Accession numberMIMAT0019998
IDcel-miR-4812-5p
Previous IDscel-miR-4812
Stem-Loop cel-mir-4812
Sequence
aagagcgcuuguagugaguugu
Get sequence
Deep sequencing100 reads, 15 experiments
Database links
QuickGO function

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).