Mature sequence cel-miR-4814-5p

Accession numberMIMAT0020002
IDcel-miR-4814-5p
Previous IDscel-miR-4814*
Stem-Loop cel-mir-4814
Sequence
uucucaaccaacuuuggccacu
Get sequence
Deep sequencing23 reads, 10 experiments
Database links
QuickGO function

References

1
PMID:21085120 "Formation, regulation and evolution of Caenorhabditis elegans 3'UTRs" Jan CH, Friedman RC, Ruby JG, Bartel DP Nature. 469:97-101(2011).
2
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).