Mature sequence dme-miR-4967-3p

Accession numberMIMAT0020193
IDdme-miR-4967-3p
Stem-Loop dme-mir-4967
Sequence
uaacaaagggcauuugcaaugu
Get sequence
Deep sequencing6 reads, 4 experiments

References

1
PMID:21177969 "Deep annotation of Drosophila melanogaster microRNAs yields insights into their processing, modification, and emergence" Berezikov E, Robine N, Samsonova A, Westholm JO, Naqvi A, Hung JH, Okamura K, Dai Q, Bortolamiol-Becet D, Martin R, Zhao Y, Zamore PD, Hannon GJ, Marra MA, Weng Z, Perrimon N, Lai EC Genome Res. 21:203-215(2011).