Mature sequence cel-miR-58b-5p

Accession numberMIMAT0020361
IDcel-miR-58b-5p
Previous IDscel-miR-1834*
Stem-Loop cel-mir-58b
Sequence
gacucggugugugaucucuua
Get sequence
Deep sequencing7 reads, 5 experiments

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).
2
3