Mature sequence ath-miR5022

Accession numberMIMAT0020527
IDath-miR5022
Stem-Loop ath-MIR5022
Sequence
gucaugggguaugaucgaaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21357774 "MicroRNA activity in the Arabidopsis male germline" Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD J Exp Bot. 62:1611-1620(2011).