Mature sequence tae-miR5085

Accession numberMIMAT0020567
IDtae-miR5085
Stem-Loop tae-MIR5085
Sequence
aaggacauuuuuuguggccug
Get sequence
Deep sequencing27 reads, 22 experiments

References

1
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).