Mature sequence ssc-miR-491

Accession numberMIMAT0020592
IDssc-miR-491
Stem-Loop ssc-mir-491
Sequence
aguggggaacccuuccaugagg
Get sequence
Deep sequencing210 reads, 12 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).