Mature sequence ssc-miR-1343

Accession numberMIMAT0020596
IDssc-miR-1343
Stem-Loop ssc-mir-1343
Sequence
cuccuggggcccgcacucucgc
Get sequence
Deep sequencing116 reads, 14 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).