Mature sequence mmu-miR-5100

Accession numberMIMAT0020607
IDmmu-miR-5100
Stem-Loop mmu-mir-5100
Sequence
ucgaaucccagcggugccucu
Get sequence
Deep sequencing34220 reads, 104 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:21403133 "Ordered progression of stage-specific miRNA profiles in the mouse B2 B-cell lineage" Spierings DC, McGoldrick D, Hamilton-Easton AM, Neale G, Murchison EP, Hannon GJ, Green DR, Withoff S Blood. 117:5340-5349(2011).