Mature sequence bdi-miR164f

Accession numberMIMAT0020741
IDbdi-miR164f
Stem-Loop bdi-MIR164f
Sequence
uggagaagaagggcacaugca
Get sequence
Deep sequencing reads, experiments

References

1