Mature sequence bdi-miR395m

Accession numberMIMAT0020744
IDbdi-miR395m
Stem-Loop bdi-MIR395m
Sequence
ugaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1