Mature sequence dme-miR-962-3p

Accession numberMIMAT0020857
IDdme-miR-962-3p
Stem-Loop dme-mir-962
Sequence
acuucaguuucauuaccuuuca
Get sequence
Deep sequencing179 reads, 17 experiments
Database links
QuickGO function

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).