Mature sequence dme-miR-973-3p

Accession numberMIMAT0020870
IDdme-miR-973-3p
Stem-Loop dme-mir-973
Sequence
ucuguucauucuccgacacaag
Get sequence
Deep sequencing52 reads, 16 experiments
Database links
QuickGO function

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).