Mature sequence osa-miR319a-5p

Accession numberMIMAT0020914
IDosa-miR319a-5p
Stem-Loop osa-MIR319a
Sequence
agcugccgaaucauccauuca
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:21525786 "Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus" Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D RNA Biol. 8:538-547(2011).