Mature sequence osa-miR444a-5p

Accession numberMIMAT0020918
IDosa-miR444a-5p
Stem-Loop osa-MIR444a
Sequence
gcuagagguggcaacugcaua
Get sequence
Deep sequencing242 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).
2
PMID:18353984 "Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs)" Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D, Liu B, Cao X, Meyers BC, Green PJ Proc Natl Acad Sci U S A. 105:4951-4956(2008).
3
PMID:21791435 "Differential expression of the microRNAs in superior and inferior spikelets in rice (Oryza sativa)" Peng T, Lv Q, Zhang J, Li J, Du Y, Zhao Q J Exp Bot. 62:4943-4954(2011).