Mature sequence gma-miR5035-5p

Accession numberMIMAT0021058
IDgma-miR5035-5p
Previous IDsgma-miR5035
Stem-Loop gma-MIR5035
Sequence
cuucuaaacauuuuuucccuua
Get sequence
Deep sequencing reads, experiments

References

1
2