Mature sequence zma-miR444a

Accession numberMIMAT0022261
IDzma-miR444a
Stem-Loop zma-MIR444a
Sequence
ugcaguuguugucucaagcuu
Get sequence
Deep sequencing2800 reads, 17 experiments
Database links
QuickGO function

References

1
PMID:21421552 "SplamiR--prediction of spliced miRNAs in plants" Thieme CJ, Gramzow L, Lobbes D, Theissen G Bioinformatics. 27:1215-1223(2011).