Mature sequence hsa-miR-548at-5p

Accession numberMIMAT0022277
IDhsa-miR-548at-5p
Stem-Loop hsa-mir-548at
Sequence
aaaaguuauugcgguuuuggcu
Get sequence
Deep sequencing2380 reads, 120 experiments
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
2
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).