Mature sequence gma-miR5670a

Accession numberMIMAT0022452
IDgma-miR5670a
Previous IDsgma-miR5670
Stem-Loop gma-MIR5670a
Sequence
caucauaccauauuugcuucau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).