Mature sequence hvu-miR171-5p

Accession numberMIMAT0022971
IDhvu-miR171-5p
Stem-Loop hvu-MIR171
Sequence
uguuggcucgacucacucaga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18521122 "Data mining for miRNAs and their targets in the Triticeae" Dryanova A, Zakharov A, Gulick PJ Genome. 51:433-443(2008).
2
PMID:20676715 "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" Kantar M, Unver T, Budak H Funct Integr Genomics. 10:493-507(2010).
3
PMID:21352554 "Discovery of barley miRNAs through deep sequencing of short reads" Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U BMC Genomics. 12:129(2011).
4
PMID:22489137 "Identification and characterization of microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing" Lv S, Nie X, Wang L, Du X, Biradar SS, Jia X, Weining S Int J Mol Sci. 13:2973-2984(2012).
5
PMID:23324356 "Developmentally regulated expression and complex processing of barley pri-microRNAs" Kruszka K, Pacak A, Swida-Barteczka A, Stefaniak AK, Kaja E, Sierocka I, Karlowski W, Jarmolowski A, Szweykowska-Kulinska Z BMC Genomics. 14:34(2013).