Mature sequence mtr-miR5037c

Accession numberMIMAT0023153
IDmtr-miR5037c
Stem-Loop mtr-MIR5037c
Sequence
aacccucaaaggcuuccacgg
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).