Mature sequence hco-miR-84b

Accession numberMIMAT0023507
IDhco-miR-84b
Stem-Loop hco-mir-84b
Sequence
ugagguaguuaagcacaggua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).