Mature sequence hsa-miR-6069

Accession numberMIMAT0023694
IDhsa-miR-6069
Stem-Loop hsa-mir-6069
Sequence
gggcuagggccugcugccccc
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).