Mature sequence hvu-miR6213

Accession numberMIMAT0024841
IDhvu-miR6213
Stem-Loop hvu-MIR6213
Sequence
acagauugcuacagacugguc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22489137 "Identification and characterization of microRNAs from barley (Hordeum vulgare L.) by high-throughput sequencing" Lv S, Nie X, Wang L, Du X, Biradar SS, Jia X, Weining S Int J Mol Sci. 13:2973-2984(2012).