Mature sequence osa-miR6251

Accession numberMIMAT0024874
IDosa-miR6251
Stem-Loop osa-MIR6251
Sequence
uguguagccacauuguaaggg
Get sequence
Deep sequencing61 reads, 2 experiments

References

1
PMID:22585409 "Novel miRNAs in the control of arsenite levels in rice" Liu Q Funct Integr Genomics. 12:649-658(2012).